Анатолий Клёсов.

ДНК-генеалогия от А до Т



скачать книгу бесплатно

Предисловие

Приветствую вас, уважаемый читатель. Книга, которую вы держите в руках – расширенное, черно-белое издание многоцветной иллюстративной книги «Ваша ДНК-генеалогия», вышедшей в этом же, 2016 году. Но в «Вашей ДНК-генеалогии» упор делался на сжатый текст, цветные иллюстрации, минимум деталей расчетного характера, и значительную часть книги занимали сведения о ранних предках человека, которые жили сотни тысяч и миллионы лет назад, об общих предках человека и шимпанзе, гориллой, орангутаном, макакой, о неандертальцах, денисовцах, то в этой книге подаваемый материал уже не так скован «телеграфной» подачей интересных сведений об истории человека и его предшественниках. Он – шире, более информативный, насыщен тем, что было осознанно опущено в «Вашей ДНК-генеалогии».

В книге последовательно рассматриваются все основные гаплогруппы человека, начиная с серии гаплогрупп А, примерно с 220 тысяч лет назад, разделение эволюционного пути Homo sapiens на африканскую и неафриканскую линии примерно 160 тысяч лет назад, заселение евразийского, африканского, американского и австралийского континентов, основные древние миграции человечества, приведшие к формированию современного населения западной, центральной и восточной Европы, формированию этнических русских, украинцев, белорусов, поляков, литовцев, латышей, балканских и других славянских народов, финно-угорского населения, кавказцев, народов Средней Азии, евреев, арабов, басков и многих других народов и народностей. Описаны древние арийские миграции, потомками которых являются часть современных славянских народов, населения Передней, Средней и Центральной Азии, Кавказа, Ближнего Востока, Ирана, Индии, Южной Сибири, Юго-Восточной Азии.

В книге показана связь многих древних археологических кулыур друг с другом и с их потомками, современным населением Западной и Восточной Европы, показана прямая связь древних культур Русской равнины с современными европейцами, как западноевропейцами, так и этническими русскими, кавказцами, таджиками, киргизами, пуштунами и другими народами и этносами. Показано также, что прямая ДНК-генеалогическая связь с древними людьми выявляется не только на уровне популяций, этносов, народов, но и на персональном, некласссифицированном уровне. В книге приводятся многочисленные примеры персональных ДНК-генеалогий, уходящих вглубь времен на многие века и тысячелетия.

Я не знаю, какой в итоге будет сформулирована русская (или российская) национальная идея, но то, что она не может быть адекватно сформулирована без учета и без знания истории наших предков, это совершенно определенно. А без знания своих предков патриотизм – просто пустое слово.

У него тогда нет основы. То, что хлёстко называют «последним прибежищем негодяя» – это и есть патриотизм без основы. Только эта хлёсткость не про патриотизм, она – про негодяя. Характерная особенность русофобов в том, что они не там в этой фразе ударение ставят. Надо на негодяе, а они – на патриотизме. Впрочем, на то они и русофобы.

Надо подчеркнуть, что эта книга – не справочник по гаплогруппам. Справочников много – это и энциклопедии, и проекты по гаплогруппам, охватывающие сотни и тысячи представителей разных народов и регионов, и множество справочных сайтов по этой тематике в сети. Цель этой книги – не гнаться за исчерпывающими сведениями, а дать много наглядных примеров по всем основным гаплогруппам эволюции человечества, от времен их образования до наших современников, живущих на всех материках и континентах, где вообще живут люди. И не только дать много наглядных примеров, но дать их так, чтобы каждый читатель книги мог примерить их на себя.

Об этом – книга, которая перед вами, дорогие читатели.

Введение

О мировоззрении и желании изучать историю мира, историю своего народа, историю своего рода и своей ДНК-линии


Огромное количество людей хотят изучать историю мира, народа, рода, свою родословную. Когда-то я имел отношение к проведению опроса людей, которые прошли тест на ДНК, и узнали свои гаплотип и гаплогруппу. Основной вопрос был такой – изменило ли это вашу жизнь? Из многих десятков людей ни один не ответил, что остался безразличным к результатам тестирования. Все ответили, что в определенной степени (иногда в большой) это их жизнь изменило. Большинство продолжили анализ своей ДНК на более глубоком уровне, и расширили изучение истории мира, своего народа, своей родословной.


Результаты ДНК-тестирования мужчин в рамках ДНК-генеалогии сводятся к двум основным показателям. Это – гаплотип и гаплогруппа. Гаплотип – это набор чисел, который является «личным номером ДНК-паспорта» любого мужчины, без исключения. А гаплогруппа, фигурально говоря, это обложка паспорта. Это – не индивидуальная, а групповая характеристика. Гаплогруппа определяет носителя гаплотипа в определенный род, или историческое племя. У любой гаплогруппы, как у любого рода или племени, был один общий предок, патриарх. Поэтому как номер паспорта при наличии обложки является уникальным «определителем» человека, так и гаплотип в совокупности с гаплогруппой являются не менее уникальным определителем человека, при условии, что номер (гаплотип) является достаточно протяженным. Примеры даны ниже в этой книге.

Если у человека такого номера и паспорта нет, то это не мужчина, а женщина. Именно к такой методологии сейчас нередко приходят археологи, которые именно так наиболее надежно определяют пол скелетного остатка в древнем захоронении. Нет в ДНК Y-хромосомы, нет мужского гаплотипа и мужской гаплогруппы – значит, женщина. У последних – свой ДНК-паспорт, под названием «митохондриальная ДНК», который они передают своим детям, как девочкам, так и мальчикам. А отец передает исключительно Y-хромосому, и только, разумеется, сыновьям.


У каждого мужчины в Y-хромосоме своя картина мутаций. У близких родственников картина мутаций похожа, потому что они, родственники, сравнительно недавно произошли от одного общего предка, и дополнительные мутации в их Y-хромосомах еще не успели образоваться. Если общий предок жил тысячелетия назад, то картина мутаций у разных потомков разная. Как эту картину отображают?

Отображают картину мутаций в виде так называемых гаплотипов, упомянутых выше как «личный номер паспорта» каждого мужчины, а именно в виде определенных последовательностей чисел, характерных для каждого человека. Чем эта последовательность длиннее, тем уникальнее гаплотип. Например, у автора этих строк гаплотип Y-хромосомы, состоящий из 111 чисел, записывается в следующем виде:


13 24 16 11 11 15 12 12 10 13 11 17 – 16 9 10 11 11

24 14 20 34 15 15 16 16 – 11 11 19 23 15 16 17 21

36 41 12 11 – 11 9 17 17 8 11 10 8 10 10 12 22 22 15

10 12 12 13 8 15 23 21 12 13 11 13 11 11 12 13 – 31

15 9 15 12 25 27 19 12 12 12 12 10 9 12 11 10 11 12

30 12 14 25 13 9 10 18 15 20 12 24 15 12 15 24 12 23

19 11 15 179 11 11


Это – так называемый 111 – маркерный гаплотип. Здесь первое число показывает, что в одном из маркеров, или локусов Y-хромосомы определенная последовательность нуклеотидов (в данном случае квадруплет AGAT, то есть аденин-гуанин-аденин-тимин) повторяется 13 раз. В другом маркере, который здесь показан как следующий, блок нуклеотидов (TCTG, то есть тимин-цитозин-тимин-гуанин) повторяется 24 раза, и так далее. У каждого маркера – своя комбинация нуклеотидов.

В академических публикациях по популяционной генетике, впрочем, пока продолжают использовать гаплотипы от 8– до 17-маркерных. В ДНК-генеалогии обычным является использование 67-и 111-маркерных гаплотипов.

В итоге многолетних наблюдений я пришел к выводу, что изучение своей родословной, особенно с привлечением ДНК-генеалогии, безусловно, влияет на наш современный уровень жизни, благосостояние, самооценку, достоинство. Более того, знание и ощущение своего прошлого и прошлого страны, прошлого своего народа каким-то удивительным образом связано с личным миропониманием и мироощущением, и через него – с уровнем личного достоинства и уровнем жизни семьи и всего сообщества.


Откуда подучают те числа, которые показаны в гаплотипах? Всё это на самом деле четко определено и зафиксировано. В первом маркере (под названием DYS393) повторяется четверка нуклеотидов AGAT, то есть аденин-гуанин-аденин-тимин


GTGGTCTTCTACTTGTGTCAATAC/AGAT/

AGAT/AGAT/AGAT/AGAT/AGAT/

AGAT/AGAT/AGAT/AGAT/AGAT/AGAT/

AGAT/AGAT/ATGTATGTCTTTTCT

ATGAGACATACCTCATTTTTTGGACTTGAGT

TC,


и повторы обрамляются уже неупорядоченными последовательностями нуклеотидов в ДНК, так называемыми фланкирующими, как показано выше. Этот участок в ДНК и есть локус, он же маркер DYS393. Во втором маркере, под названием DYS390, повторяется уже другая четверка – TCTG, то есть тимин-цитозин-тимин-гуанин, которая переходит в четверку ТСТА, то есть тимин-цитозин-тимин-аденин, и число повторов складывается:


TATATTTTACACATTTTTGGGCCCTGCATTT

TGGTACCCCATAATATATTCTATCTA/

TCTG/TCTG/TCTG/TCTG/TCTG/TCTG/

TCTG/TCTA/TCTA/TCTA/TCTA/TCTA/TCTA/

TCTA/TCTA/TCTA/TCTA/TCTA/TCTA/TCTG/

TCTA/TCTA/TCTA/TCATCTATCTATCTTT

CCTTGTTTCTGAGTATACACATTGCAATGTT

TTCATTTTACTGTCAC.


Перечисленные четыре нуклеотида – это язык ДНК, который состоит из четырех букв при сокращенной записи. Эти нуклеотиды комбинируются парами, их так и называют – «пары оснований». Они фактически держат двойную спираль ДНК. Нам эти четверки (а также тройки нуклеотидов, и другие типы повторов) в маркерах ДНК в дальнейшем не понадобятся, это описание мы даем только для того, чтобы показать, что за числами в гаплотипах стоят масштабные исследования, которыми занимаются в мире сотни и тысячи человек.


Приведу свой личный пример. Полтора десятка лет назад я довольно случайно узнал о возможности определить свои гаплогрупп и гаплогруппу. Причем узнал от весьма малоаппетитной личности, с которым имел немало коллизий в сетевых дискуссиях, узнал, когда тот похвалялся, что анализ ДНК показал, что он – «чистый русский». Меня заинтересовало, как ДНК это может показать, и что такое «чистый русский». Как и оказалось, та похвальба была, как обычно у него, пустой. Никакой гаплотип или гаплогруппа не показывают, что некто есть «чистый русский», «чистый украинец», или «чистый еврей». Это вообще «перпендикулярные» понятия, так сказать. Но гаплотип и гаплогруппа показывают род, показывают (в совокупности с другими гаплотипами или гаплогруппами), откуда род ведет свои корни, когда и где (при наличии дополнительных исследований) жили предки рода, пути и времена древних миграций, связь с древними археологическими культурами.


Естественно, чем протяженнее гаплотип, тем выше вероятность того, что в нем произойдет мутация. Мутация в гаплотипах – это результат ошибки в копировании блоков нуклеотидов, тех самых «коротких тандемных повторов», биологической системой копирования ДНК в клетке. Каждый нуклеотид мутирует, то есть копирующая система ошибается при копировании протяженных гаплотипов, со средней частотой примерно 0.00178 раз в поколение при протяженности поколения 25 лет, то есть раз в 560 поколений, или раз в 14 тысяч лет. Величина поколения в 25 лет в ДНК-генеалогии называется условным поколением, она – сугубо математическая величина. Если кому-то больше нравится брать 30 лет за поколение, то вероятность мутации за 30 лет составит примерно 0.00214, или раз в 468 поколений (по 30 лет), или раз в 14 тысяч лет. Как видим, конечный результат получается точно такой же.

Итак, у любого человека можно выявлять гаплотип с разным разрешением, это будет один и тот же «ДНК-генеалогический паспорт», только разрешение, естественно, тем больше, чем более протяженный гаплотип. Надо сказать, что наука не остановилась на 111-маркерном гаплотипе, и, например, у того же автора определен уже 431 – маркерный гаплотип:


13 24 16 11 11 15 12 12 10 13 11 30 16 9 10 11 11 24

14 20 34 15 15 16 16 11 11 19 23 15 16 17 21 36 41

12 11 11 9 17 17 8 11 10 8 10 10 12 22 22 15 10 12 12

13 8 15 23 21 12 13 11 13 11 11 12 13–31 15 9 15

12 25 27 19 12 12 12 12 10 9 12 11 10 11 12 30 12 14

25 13 9 10 18 15 20 12 24 15 12 15 24 12 23 19 11 15

17 9 11 11–10 12 15 15 10 10 8 8 9 13 7 8 10 10 13

14 14 15 31 32 11 10 9 9 8 24 8 8 8 16 22 22 24 21 23

14 16 25 28 15 15 6 11 14 15 8 14 11 12 10 11 10 10

11 11 18 10 12 10 7 10 5 8 9 5 5 11 15 8 29 6 7 10 13

11 6 7 7 7 16 10 11 16 22 23 11 12 12 10 7 12 12 13 7

3 20 18 11 11 8 9 13 13 10 11 22 12 16 13 14 11 11 12

10 12 9 13 9 12 11 12 16 7 14 12 10 9 10 4 7 7 13 13

12 11 9 11 10 11 14 8 4 8 6 11 11 16 9 11 13 19 12 12

9 10 9 9 11 11 9 9 14 14 15 9 7 10 12 14 13 14 14 12

6 32 10 11 16 8 7 17 17 11 11 6 13 12 13 11 10 7 13

12 7 – 12 12 7 14 17 17 11 25 8 8 12 8 8 1113 11 12

10 8 13 8 13 14 10 11 9 20 17 15 36 9 13 14 39 33 36

9 10 10 12 18 19 13 9 14 44 10 8 14 9 8 20 11 11 11

11 10 9 9 9 8 8 8 8 9 11 9 23 11 9 16 31 8 20 8 13 12 8

16 10 9 33 27 23 22 10 8 12 10 8 14 8 8 32 55 7 7 5 9

6 11 11 11 13 9 39 33 7 8 27 7 5 13 7 15 28 25 60 42

12 31 22 20 12 3 4


Таких гаплотипов в мире определено пока всего несколько десятков, так что практическая польза от них пока невелика, за исключением нескольких специальных случаев, которые будут пояснены ниже.

Поскольку «коротких тандемных повторов» в Y-хросомоме многие тысячи (выше показано 431 таких повторов, и это только среди 10 миллионов нуклеотидов Y-хромосомы, этот размер определяется методологией исследования; всего же в Y-хромосоме примерно 58 миллионов нуклеотидов, или, точнее, нуклеотидных пар, но не будем здесь вдаваться в излишние подробности). Отсюда можно заключить, что таких «тандемных повторов» в Y-хромосоме может быть примерно 2500, и это, видимо, максимально возможный размер гаплотипа.


Как читатель видит, я не делаю из своего гаплотипа (см. врезку) какой-то секрет, и другим не советую. В нашем мире глобальной информации, где о каждом из нас в сети имеется масса сведений, значительно более потенциально вредоносных, раскрытие гаплотипа вообще никакой опасности не представляет. Гены не имеют к нему никакого отношения, никаких сведений о здоровье или медицинской диагностики в гаплотипе нет, именно потому, что там нет генов. Байки о том, что якобы на гаплотип можно нацелить некое биологическое оружие, не только безосновательны, но и глупы. Такое «биологическое оружие» нацеленное, например, на гаплотип группы R1a, которая есть у половины русских, положило бы почти половину литовцев и латышей, половину украинцев и поляков, треть немцев и шведов с норвежцами, и не менее 20 % жителей США и Канады. Поэтому уже сотни тысяч человек, в основном из стран Запада, заносят свои гаплотипы в общедоступные базы данных, и никаких опасений по этому поводу не испытывают.


Гаплотипы выбирают так, чтобы в них маркеров было как можно больше (но все-таки чтобы оставаться в рамках практичности), и в ранних академических работах использовались 6-маркерные гаплотипы, затем 12-маркерные, 17-и 19-маркерные, затем 25– и 37-маркерные, а сейчас работа рутинно ведется с 67– и 111 – маркерными гаплотипами (правда, в академических публикациях это обычно от 8 до 17 маркерных гаплотипов). В 111-маркерных гаплотипах одна мутация происходит в среднем за 5 поколений, поэтому у 111 – маркерных гаплотипов разрешение лучше других. Но их определять дороже, чем более короткие, поэтому в академических исследованиях, при постоянной нехватке денежных средств, приходится работать с более короткими гаплотипами. Протяженные гаплотипы определяют в коммерческих компаниях, обычно персонально, по индивидуальному заказу, и передают в общественные базы данных, если носитель гаплотипа не возражает. Правда, у возражений практически никогда нет оснований, это всегда «нутряное» «как бы чего не вышло». Сейчас в общественных базах данных – сотни тысяч гаплотипов, и базы прирастают многими гаплотипами ежедневно.

Как мы покажем ниже, эти гаплотипы, а именно числа в них, напрямую связаны с хронологией древних миграций людей, переходами людей на новые места, событиями прошлого – войнами, климатическими катаклизмами, эпидемиями, в общем, со всем тем, что так или иначе влияло на численность популяций человека в определенные времена и на определенных территориях. Например, расчеты могут показать когда носители гаплогруппы N были на Урале, когда они появились в Прибалтике, когда древние арии появились на Русской равнине, когда они появились в Индии, Иране, на Ближнем Востоке – потому что эти события приводили к появлению на этих территориях и в те времена общих предков популяций, потомки которых увеличивались в числе вплоть до нашего времени, образуя «кусты» гаплотипов со всеми мутациями в них, то есть изменениями чисел в маркерах.


Я заказал определение своих гаплотипа и гаплогруппы в соответствующей компании, и вскоре получил ответ. Ответ меня заинтриговал, и я отправился в архивы, военные и региональные, искать своих предков. Пошла обильная информация, о которой я не имел ранее никакого понятия. Оказалось, что мои прямые предки – из детей боярских, древнего военно-боевого дворянского сословия, что десятки моих прямых и близких родственников охраняли границы Руси, что мой предок ходил с Петром Первым брать Азов, и оттуда участвовал в Казикерменском походе, о котором я ничего не знал, а сейчас знаю много, и оказалось, что у нас в Курской области есть фамильная деревня, земля для которой была выделена моему прямому предку Ивану Клёсову в 1639 году царским указом за боевую службу.

Я отправился в ту деревню Клёсово, взял у жителей той деревни образцы ДНК, отправил на анализ, и увидел, что это на самом деле мои гаплотип и гаплогруппа, и всего несколько мутаций в гаплотипах показали, что наш общий предок жил в конце 16-го века, о чем и рассказали до того архивы. Дальнейшие исследования, еще более глубокие, показали, что мой гаплотип и субклад – выходцы из восточнокарпатской ветви гаплогруппы R1a, общий предок которой жил в I тыс до н. э., во времена зарождения славянства в том виде, в каком его понимают историки. Но анализ моей Y-хромосомы прошел дальше – мои предки жили в археологической фатьяновской культуре, которая располагалась в центральном европейском регионе современной Российской Федерации примерно 4500–3500 лет назад, и вполне может быть названа древнерусской археологической культурой. В свою очередь ее предки – археологическая культура боевых топоров, начиная примерно с 5200 лет назад. Ископаемые ДНК последней, с археологической датировкой 4600 лет назад – имеют гаплотип, практически такой же, какой у меня. Мои корни, как и корни любого мужчины на планете, описаны в этой книге, в ее разных главах, только я могу примерить всю эту информацию на себя, а те, кто не знают своих гаплотипа-гаплогруппы, не могут. В этом – большая разница в мироощущении между нами.


Обратимся к гаплогруппам, тем самым «обложкам паспорта», групповым характеристикам. Большое число мутаций и, соответственно, большое временное расстояние между гаплотипами разных гаплогрупп (десятки тысячелетий) вызвано тем, что они относятся к разным родам человека, а относительно умеренное расстояние между двумя гаплотипами одной гаплогруппы (и к тому же одного субклада), часто всего несколько тысяч лет, и вызвано тем, что они фактически родственники, в рамках понятий ДНК-генеалогии. В целом понятия гаплогруппы и субклада часто взаимозаменяемы, и определяются контекстом изложения. И гаплогруппы, и субклады определяются необратимыми мутациями в Y-хромосоме, снип-мутациями, в отличие от обратимых мутаций, стир-мутаций, в гаплотипах (тех самых повторов, что описаны выше, которые в научной литературе называют STR, от Short Tandem Repeats). Эти снип-мутации (от сокращения SNP, Single Nucleotide Polymorphism), стараются подобрать такие (для идентификации гаплогрупп и субкладов), которые были бы стабильными за все время существования человечества. Поэтому гаплогруппы и субклады стабильны, не меняются во времени.

Всего в мире насчитывают 20 основных гаплогрупп, которые обозначают буквами латинского алфавита, от А до Т, хотя систему порой нарушают. В последнее время в классификацию добавили гаплогруппы А0 и А00, хотя их носителей обнаружили считанные единицы, все они живут в Африке. Но они настолько отстоят по снип-мутациям от всех остальных людей на Земле (тестированных на мутации в ДНК), что их пришлось выделить в отдельный род-гаплогруппу. Помимо этого, были идентифицированы промежуточные, сводные гаплогруппы, такие, как СТ, DE, GHIJK и другие (см. диаграмму ниже), так что минимальный состав генеалогического дерева мужской половины человечества включает уже 39 основных гаплогрупп, то есть главных уровней Y-хромосомного генеалогической структуры. С подгруппами это составляет уже много сотен.


Поскольку мы все еще во Введении, то расскажем об основных родах, или гаплогруппах, мужчин планеты. Хотя мы в этой книге время от времени обращаемся к женским линиям, мтДНК, но речь далее пойдет в основном о мужских линиях. И к этому есть серьезные причины. Женские линии митохондриальной ДНК передаются от матери к дочери непрерывной цепочкой на протяжении всего времени существования человечества и его предков миллионы лет назад, а также боковых ДНК-линий человеческой эволюции. мтДНК также передаются от матери сыну, но на последнем обрываются, потому что со сперматозоидами мтДНК от отца к матери не передаются, а если в редких случаях передаются, то это вызывает острые патологии и нередкую смерть плода или ребенка. Но не в этом причина, почему в ДНК-генеалогии мужские линии, передаваемые с Y-хромосомой, обычно более предпочтительны для рассмотрения. мтДНК дают картину гораздо более «крупными мазками», опуская множество важных деталей, на которых зачастую строится ДНК-генеалогия. Эти «крупные мазки» порой дают исключительно ценную информацию, но, как показывает опыт, только в отдельных случаях, намного удаленных во времени.



скачать книгу бесплатно

страницы: 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26

сообщить о нарушении